Electroporation assisted delivery of Roussin salt porphyrin-based conjugated carbon nanoparticles for sono–X-ray–photodynamic prostate cancer in vitro and in vivo treatment

Abstract

Background

In the realm of cancer treatment, sono–X-ray–photodynamic therapy (SXPDT) has garnered significant interest as a novel therapeutic approach. The essential part of SXPDT is the sensitizer, which under X-ray photon and ultrasound sono-irradiation may transform sono and photo-energy into cytotoxic molecules. Photon absorption, targeting, penetration, and oxygen dependence remain challenges in sono–X-ray–photosensitizer (SXPs) design. Rapid advancements in material science have prompted the creation of several SXPs that create cytotoxic species with great selectivity, safety, and noninvasiveness for the treatment of tumors. The current study aims to provide an advanced method of activated cancer treatment by using electroporation to assist the delivery of Roussin salts porphyrin-based conjugated carbon nanoparticles (EP@RRBP-CNP) for the sono–X-ray–photodynamic prostate cancer (PCa) in vivo and in vitro treatment.

Materials and methods

Human PCa cells (DU-145) were used in the in vitro study, and the in vivo application groups of the study protocol were Swiss albino mice treated with N-methyl-N-nitrosourea (MNU) / testosterone only; they were not given any treatment to induce PCa. The study treatment protocol started only after PCa induction, and involved daily administration of EP@RRBP-CNP as SXPDT sensitizer whether or not to be exposed to photo–(X-ray) or sono–(US) or a combination of them for 3 min for a period of 2 weeks.

Results

Indicated that CNP is a useful RRBP delivery mechanism that targets PCa cells directly. Furthermore, EP@RRBP-CNP is a promising SXPS that, when used in conjunction with SXPDT, can be very effective in in vitro treating PCa-DU-145 (in a dose-dependent manner cell viability declined, an increase in the cells population during the G0/G1-phase indicates that the cell cycle was arrested, and an increase in cell population in the Pre-G, autophagic cell death, as well as necrosis and early and late apoptosis, indicate that cell death was induced) and MNU/testosterone-PCa-induced mice in vivo (induced antiproliferative genes, p53, Bax, TNFalpha, caspase 3,9, repressed antiangiogenic and antiapoptotic genes, VEGF and Bcl2, respectively), successfully slowing the growth of tumors and even killing cancer cells, as well as lowering oxidative stress (MDA), improving the functions of the kidneys (urea, creatinine), liver (ALT, AST), and antioxidants (GPx, GPx, GST, CAT, GSH, TAC). SXPDT, the X-ray photo- or sono-chemical RRBP activation mechanism, and the antioxidant capacity of non-activated RRBP can all be linked to this process.

Conclusion

On the bases of the findings, EP@RRBP-CNP shows a great promise as a novel, efficient selective delivery system for localized SXPDT-activated prostate cancer treatment.

Introduction

Prostate cancer (PCa) is one of the leading causes of morbidity and mortality in developing and underdeveloped nations. In comparison to other cancers, PCa is the most prevalent non-skin cancer and the second leading cause of mortality for males when compared to other malignancies. According to global demographic trends GLOBOCAN, PCa is the sixth most frequent cancer in Egypt and the fourth cancer worldwide. PCa can be both localized and progressed, depending on the severity. PCa can spread through the lymphatic system and infiltrate the bones (Taitt 2018; Rawla 2019; Barani et al. 2020). PCa appears to be caused by a variety of factors, including age, genetics, environmental pollutants, chemical dangers, and radiations, but the specific mechanism remains unknown. Androgens contribute to the prostate's normal development and functions, yet even at this stage they have the potential to cause cancer. Analogously, obesity and insulin resistance linked to hyperinsulinemia can also directly raise the risk of PCa (Fujita et al. 2019; Banerjee et al. 2018). Magnetic resonance imaging (MRI), biopsy, prostate-specific antigen (PSA) testing, physical examination, and staging are among the known PCa diagnostic techniques. Diagnosing PCa is difficult due to the large number of gaps caused by over-testing, -diagnosis, and -treatment, as well as the non-specificity and heterogeneity of the disease (Litwin and Tan 2017; Schatten 2018).

Various treatment methods are in place to lower the aforementioned risk of PCa, and for benign stage cancer, no therapy is necessary. Additionally, the prostate glands, together with any associated tissues and lymph nodes, may be surgically removed in cases of metastatic invasion. PCa is frequently treated with radiation therapy as well. External beam radiation and internal radiation (brachytherapy) are the two ways in which PCa radiation therapy can be administered. Hormone replacement therapy is the third most significant treatment for PCa. A prostate tissue freezing is also used to eliminate cancer cells. If hormone replacement therapy fails to produce desired results, chemotherapy can be used to eliminate deadly and extremely aggressive cancer cells. Regretfully, erectile dysfunction, obesity, bone loss, and libido are linked to all of these treatment modalities (Mayor de Castro et al. 2018; Mohler and Antonarakis 2019; Adamaki and Zoumpourlis 2021).

When it comes to treating well-known tumors and a range of intracellular disorders, nanomedicine has completely changed medicine and diagnosis by avoiding traditional treatment protocols. Applications of nanotechnology in medicine may result in improved solubility, permeability retention, transmembrane penetration, and customized drug delivery. Active or passive targeting of nanoparticles can result in their accumulation in tumor tissues (Barani et al. 2020; Wakaskar 2017; Wu et al. 2020; Zhao et al. 2022).

The overall survival rate of PCA patients can be raised by doing in-depth research and creating innovative treatments for malignant tumors. One of the alternative therapeutic techniques for PCa is called sono–X-ray–photo-dynamic therapy (SXPDT), which combines X-ray-photo- and ultrasound-irradiation with sensitizer. Sono-dynamic treatment (SDT), which takes its cues from photodynamic therapy (PDT), has gained attention as a potentially useful noninvasive treatment. Because of its shallow light penetration depth, PDT is not useful in treating tumors that are deeply ingrained. But the primary advantage of SDT over PDT is that US can be precisely targeted and penetrate soft tissue up to several tens of centimeters. Thus, SDT overcomes the primary flaw with PDT. In recent years, the use of SXPDT to treat a variety of tumors has grown in popularity, either by itself or in combination with other forms of treatment. In order to trigger a variety of biological processes, SXPDT entails giving a sensitizing agent and the malignant area then exposed to X-ray and ultrasound with the same absorption resonance band as the SXPS (Ren et al. 2018; Ahmad et al. 2019; Deng et al. 2021; Gadzhimagomedova et al. 2020; Yao et al. 2023; Zhang et al. 2023).

Roussin first reported the existence of iron-sulfur-nitrosyl cluster anions of the type FexSy(NO)zn in 1858. Specifically, Roussin's black salt (RBS, NH 4[Fe 4S3(NO) 7]) and red salt (RRS, Na2[Fe 2S 2(NO)4]) have been studied as possible carriers for the thermal or photochemical delivery of reactive oxygen species (ROS). Furthermore being tried for use in photochemistry as vehicles for delivering ROS in order to sensitize radiation damage, RBS can efficiently deliver ROS in cell cultures where it rapidly releases ROS under photo irradiation (Bourassa et al. 1997; Janczyk et al. 2004; Hopmann et al. 2009; Wang et al. 2009; Chen et al. 2017; Lan et al. 2020; Tan et al. 2017).

The present study offers a different approach to reducing the harmful effects of traditional therapies. Additionally, novel approaches to the treatment of malignant tumors are currently being researched and developed, which raises the standard of patient survival. As a result, the main goal of this work is to propose a novel investigation into the electroporation-assisted delivery of Roussin salts porphyrin-based conjugated carbon nanoparticles for sono–X-ray–photodynamic prostate cancer treatment in vitro and in vivo. It has not been thoroughly investigated how Roussin salts porphyrin-based conjugated carbon nanoparticles (RRBP-CNP) works as anticancer or the potential uses for it as a SXPS for SXPDT.

Materials and methods

Materials

All of the chemicals used were obtained from commercial sources and didn't need to be further purified. Roussin's red, black salts and porphyrin were obtained from (Sigma-Aldrich). Cairo Biodiagnostic, Egypt, provided kits measuring antioxidant total capacity (TAC), glutathione peroxidase-S-transferase, and reductase (GPx, GST, GSR), superoxide dismutase (SOD), catalase (CAT), urea, aminotransferases (aspartate AST, alanine ALT), and creatinine. Lipid peroxide (malondialdehyde; MDA) was also purchased. The cDNA H-minus ABT synthesis kit, the qPCR WizPure™ (SYBR) Master, and the total RNA (spin column) mini ABT extraction kit were purchased from Applied Biotechnology and Wizbiosolutions Inc., respectively.

RRBP-CNP preparation and characterization RRBP-CNP was applied as SXPS in the present study (Fig. 1). The CNP were synthesized and conjugated to RRBP as following; CNP were synthesized using a simple, inexpensive, and environmentally acceptable synthetic method utilizing commercial mustard oil, purchased from Aladdin Industries Inc. in Shanghai, China, was poured into a 15-ml container, and 30 mg of cotton wicks were dipped into the oil. Following the burning of the cotton in the presence of the oil, black powder was collected in a metal plate that was placed 5 cm away from the flame. For the following stage, the gathered black powder was moved to a container for grinding. After being ground in a ball mill, these particles were treated with 2 M HCl and then neutralized with NaOH. To get rid of any unreacted impurities, it was then annealed at 800 °C. CNP were finally gathered. RRBP-CNP; involved sonicating 250 mg of CNP for 30 min in deionized water of 500 ml. To enable RRBP adsorption on CNP, 50 ml of aqueous pH of 7.4 sterilized solution buffer was added to the combination along with RRBP. The mixture was then left to agitate for a whole day without refrigeration. We then dialyzed the entire system against deionized water for a full day (Kim et al. 2019; Bhandari et al. 2021; Conrado et al. 2004). RRBP-CNP was characterized by measuring its size and shape, RRBP-CNP was examined using a particle size analyzer, Fourier transform scanning infrared spectroscopy (FTIR), absorbance and photoluminescence scanning spectrometry (UV/visible, PL), scanning energy dispersive and diffraction X-ray (EDX, XRD), transmission and scanning electron (TEM, SEM) microscopy, and zeta potential. PCa-DU-145 cell lines treated with RRBP-CNP and the MNU/testosterone-PCa-induced mice groups (ip injected) were given 9–12 h to incubate before being subjected to XPDT and/or SDT for a period of 2 weeks.

Fig. 1

Schematic illustration of SXPDT and RRBP-CNP synthesis

Methods

The complete investigation and inquiry process was conducted in compliance with all relevant laws and guidelines.

Ethics statement

Institutional Animal Care and Use Committee of Alexandria University (ALEXU-IACUC; Code No. 0122092013) certified the ethical rules as well as the animal protocols guidelines.

In vitro study: 1. (Control positive group): PCa cell (DU-145) line was kept in a drug-free environment and was not treated. 2. (non-activated RRBP-CNP group): PCa cell (DU-145) line was received 0.039 µl RRBP-CNP dissolved in PBS solely alongside electroporation. 3. (X-ray subjected group): PCa cell (DU-145) line was subjected to for 3 min X-ray. 4. (X-ray RRBP-CNP activated group): PCa cell (DU-145) line was received 0.039 µl RRBP-CNP alongside electroporation and subjected as group 3 to X-ray. 5. (Ultrasound subjected group): PCa cell (DU-145) line was subjected to ultrasound for 3 min. 6. (Ultrasound RRBP-CNP activated group): PCa cell (DU-145) line was received 0.039 µl RRBP-CNP alongside electroporation and subjected as group 5 to ultrasound. 7. (Combined X-ray and ultrasound group): PCa cell (DU-145) line was subjected to X-ray and ultrasound for 3 min. 8. (Combined X-ray and ultrasound RRBP-CNP activated group): PCa cell (DU-145) line was received 0.039 µl RRBP-CNP alongside electroporation, and subjected as group 7 to X-ray and ultrasound.

In vivo study Ninety Albino mice, weighing 20 ± 5 g and aged 60 ± 5 days, were obtained from Alexandria University—Faculty of Agriculture's animal house. Experimental animals in suitable cages were housed with 12-h light—wake/dark—sleep cycles and 26 ± 0.5 °C temperature. The experimental animals had full access to tap water and were given a constant pellet diet. The drug was administered after the experimental animals had acclimated for a week. To put it briefly, the experimental animals were grouped into mouse nine groups of ten each: 1. (Control negative group): normal healthy untreated mice were kept untreated. 2. (PCa control positive group): mice were orally administered only a dose of 50 mg/kg bw N-methyl-N-nitrosourea (MNU) and 3 mg/kg bw testosterone to induce PCa and kept untreated. 3. (Non-activated RRBP-CNP group): PCa-induced mice were administered a 0.039 ml daily dose of RRBP-CNP dissolved in PBS solely alongside electroporation every day for two weeks. 4. (X-ray group): PCa-induced mice were irradiated with X-ray every day for 3 min for 2 weeks. 5. (X-ray RRBP-CNP activated group): PCa-induced mice were administered a 0.039 ml daily dose of RRBP-CNP alongside electroporation and subsequently irradiated with X-ray every day for 3 min for 2 weeks. 6. (Ultrasound group): PCa-induced mice were irradiated with ultrasound every day for 3 min for 2 weeks. 7. (Ultrasound RRBP-CNP activated group): PCa-induced mice were administered a 0.039 ml daily dose of RRBP-CNP alongside electroporation and subsequently irradiated with ultrasound every day for 3 min for 2 weeks. 8. (Combination X-ray and ultrasound group): PCa-induced mice were subjected to X-ray photon, followed by ultrasound every day for 3 min for 2 weeks. 9. (Combined X-ray and ultrasound RRBP-CNP activated group): PCa-induced mice were administered a 0.039 ml daily dose of RRBP-CNP alongside electroporation, and were irradiated with both X-ray and ultrasound every day for 3 min for 2 weeks.

Instruments

Electroporation The square wave of EP was produced by a pulse generator at #of pouring pulses 0–9 and #of transfer pulses 0–99. With many wave forms (sine, square, triangle, etc.) and a frequency counter that can track frequencies up to 20 MHz, the power supply is an AC function generator model CA1640 p-02. A power amplifier installed on the generator could provide an AC current to improve the entry through both in vitro and in vivo models.

X-ray irradiation Before the experimental animals were exposed to the X-ray, doses of (100, 10 mg/kg bw) ketamine and xylazine were used to put them to sleep. Around the tumor, there was no hair by shaving. The mouse was positioned facing the board. The X-ray was almost exactly positioned above the tumor, and the groups were treated to X-ray therapy for 3 min under previously mentioned certain conditions. The experimental animals were kept after XPDT in the dark in order to prevent skin irritation. The tumor in mice was irradiated using IRay D3 portable X-ray camera, model RAY98 (P)—Factory, China, High frequency X-ray generator (50–60 Hz), Tube (constant-65 kV), Current tube 2 mA Canon D-045 (1.7 mA), 0.4–0.8 mm tube focal spot, Target angle 12.5–20 degree and DC power 14.2–16.8 V.

Ultrasound irradiation Before the experimental animals were exposed to the ultrasound, doses of (100, 10 mg/kg bw) ketamine and xylazine were used to put them to sleep. Hair around the tumor was shaved. The mouse was positioned facing the board. The ultrasound probe was almost exactly positioned above the tumor, and the groups were treated to ultrasound therapy for 3 min under previously mentioned conditions; utilizing an electronic tube, an ultrasonic (Shanghai, CSl China, Model822) generates an alternating electric current oscillation with a frequency of 0.8 MHz. Using an ultrasonic transducer, the gadget transforms its power output into mechanical ultrasonic energy. Ultrasonic mechanical energy can be used to create a beam density of 0.5–3 W/cm². With a 1/3 duty ratio, 1000 Hz pulse frequency, and a 0.15–1 W/cm² power density average range, this device can provide power in the range of 0.5–3 W/cm². It has the ability to function in continuous and pulsed modes.

Upon completion of the experimental protocols, the experimental animals were euthanized by 5% isofurane (overdose) inhaling, and to ensure euthanasia cervical dislocation was conducted. 60 s later the mice had white eyes and no longer heartbeat. Following the dissection, entire blood and sera were extracted from blood samples. After centrifuging a portion of the blood at 1000xg for 10 min, and at – 20 °C the sera separated were stored until analysis. The blood remaining sample was taken and at −80 °C stored until the identification and evaluation of gene relative expressions was started. After then it was reconstituted into another vial containing an RNA later solution from the vial containing EDTA. Furthermore, PCa tissues were removed immediately and washed in cold saline, punctured with a needle within a vial, and stored in a 10% formalin/saline solution for histopathological analysis.

Cell culture Human prostate cancer cell DU-145 was supplied by the American Type Culture Collection (ATCC). The cells were cultured in DMEM media supplemented with 10% heat-inactivated fetal bovine serum, 100 units/mL penicillin, and 100 mg/mL streptomycin. The cells were kept at 37 °C in a humidified 5% CO₂ (v/v) environment.

Test for cell viability and cytotoxicity

Applying the sulforhodamine B (SRB) assay, the cytotoxic activity of RRBP-CNP against DU-145 cells was evaluated. Following the implanting 100 μL cell suspension of 5 × 10^3 cells in aliquots on 96-well plates, for a full day the total medium was incubated. A second aliquot of 100 μL medium containing RRBP-CNP at different doses (0.1, 1.0, 10, 100, and 1000μM) was added to the cells for treatment. Following a 24-h exposure to different modalities, both with and without RRBP-CNP, the cells were fixed by incubating them at 4 °C for an hour and changing the medium with 10% TCA 150 μL. The cells with distilled water were rinsed five times after the TCA solution was removed. After adding aliquots of (0.4% w/v) 70 μL SRB solution, they were allowed to sit for 10 min in a dark environment at room temperature. The plates with 1% acetic acid were washed three times and then left to air dry for the entire night. A BMG microplate Omega reader LABTECH®-FLUOstar (Ortenberg, Germany) was used to detect the absorbance after the protein-bound SRB stain had been dissolved with (10 mM) 150 μL of TRIS at 540 nm (Vichai and Kirtikara 2006).

Flow cytometry assay

Cell cycle analysis Trypsinization was used to gather 10⁵ DU-145 cells after 24 h of various modalities treatment, in presence and absence of RRBP-CNP. Then, the cells were cleansed in PBS twice, which was extremely cold (pH 7.4). After being re-suspended in 2 ml of 60% ice-cold ethanol, the cells were fixed at 4°C for an hour. The fixed cells were rinsed in PBS (pH 7.4) repeatedly after being suspended in 1 mL of PBS containing RNAase A 50 µg/mL and propidium iodide (PI) 10 µg/mL. The cells were examined after 20 min at 37 °C of dark incubation. The cells' DNA content was assessed using flow cytometry analysis utilizing a Novocyte™ ACEA flow cytometer (Biosciences Inc., USA) fitted with a (λex/em 535/617 nm) FL2 signal detector. For all samples, a total events of 12,000 were gathered. With the use of Novo ACEA Express™ software, the cell cycle distribution was identified (Pozarowski and Darzynkiewicz 2004).

Analysis of necrosis and apoptosis Annexin V-FITC/PIs The Abcam Inc. detection kit, Annexin V-FITC apoptosis (Cambridge, UK) was used in conjunction with two fluorescent channels flow cytometry to identify the necrosis and apoptosis cells populations. Trypsinization was used to isolate the 10⁵ total DU-145 cells after a 24-h treatment period utilizing different modalities both with and without RRBP-CNP. The cells were washed twice in ice-cold PBS pH 7.4. As directed by the manufacturer, cells were treated at room temperature for 30 min and in the dark with 0.5 ml of Annexin V-FITC/PI solution. After staining, the Novocyte™ ACEA flow cytometer was used to measure the FITC and PI fluorescence signals using signal FL1 and FL2 detectors (λex/em 488/530 nm and 535/617 nm for FITC and PI). For all samples, a total events of 12,000 were gathered. Using Novo Express™ ACEA software, positive PI and/or FITC cells were quantified and calculated via quadrant analysis (Wlodkowic et al. 2009).

Autophagy analysis Autophagic cell death was measured using flow cytometric analysis and the lysosomal dye acridine orange (AO). Trypsinization was employed to isolate DU-145 cells (10⁵ cells) following a 24-h trial of various modalities, in presence and absence of RRBP-CNP. After that, the cells were cleansed in (pH 7.4) PBS twice that was extremely cold. After the cells were stained with (10 µM) AO, they were incubated for 30 min at 37 °C in the dark. Following labeling, cells were injected using a Novocyte ACEA flow cytometer, and the signal FL1 detector (λex/em 488/530 nm) was used to analyze the AO fluorescence signals. Novo Express™ ACEA software is used to measure net fluorescence intensities (NFI) based on 12,000 events collected for each sample (Thomé et al. 2016).

Migration (wound healing) assay The impact of RRBP-CNP on DU-145 cell migration was investigated using a cell scratch test. Regarding the scratch wound investigations, DU-145 cells were seeded at a 2 × 10⁵/well density onto a coated 12-well plate. Following that, they were cultured at 37 °C in 5% FBS-DMEM and 5% CO₂ for the duration of the night. The confluent monolayer was horizontally scratched the following day. The plate was then completely cleaned using PBS. The treatment wells received new medium containing activated RRBP-CNP, while the control wells received fresh medium. At predetermined intervals, images were captured using an inverted microscope. The plate was incubated at 37 °C with 5% CO₂ in between time intervals. The acquired images are shown and analyzed by the version 3.7 MII Image View program (Justus et al. 2014).

Molecular, biochemical, and histological analyses

Liver and kidney enzymes biochemical analysis According to Burtis et al. (2008), commercial kits were used to assess the liver (AST and ALT) and kidney (creatinine and urea) (Burtis et al. 2008).

Assessment of the oxidative stress and antioxidant indicators The serum antioxidant and oxidative stress markers levels were evaluated using commercial kits. Lipid peroxidation is assumed to be indicated by levels of malondialdehyde (MDA) (Draper and Hadley 1990). SOD activity (Marklund and Marklund 1974) glutathione-peroxidase, S-transferase and reductase (GPx, GST, GR) activities (Habing et al. 1974; Khan and Sultana 2011). Catalase activity (Aebi 1984; Sharma et al. 2024). Total antioxidant activity (TAC) (Rice-Evans and Miller 1994).

Assessment of the relative gene expressions of TNF alpha, Caspase (3, 9), Bcl-2, Bax, p53, and VEGF To find the expression of the genes, qRT-PCR was utilized. The total RNA mini spin column ABT extraction kit was used to isolate total RNA from blood samples in accordance with the instructions. Purity was assessed by measuring the ratio of absorption at 260–280 nm, which was often higher than 1.8. Using a one-step RT-PCR reaction, the cDNA was synthesized as instructed by the cDNA ABT H-minus synthesis kit. Wiz Pure™ qPCR (SYBR) Master with ROX Dye was applied for qRT-PCR. A (20 µL) reaction mixture including 0.25 µM target gene primers and 5 µL of template C-DNA, P53-R is TGGAATCAACCCACAGCTGCA, and P53-F is CTGTCATCTTCTGTCCCTTC; Caspase3-R is AAATGACCCCTTCATCACCA, and Caspase3-F is TGTCATCTCGCTCTGGTACG; Caspase9-F is AGTTCCCGGGTGCTGTCTAT, and Caspase9-F is GCCATGGTCTTTCTGCTCAC; TNF-α-R is TGAGATCCATGCCGTTGGC, and TNF-α-F is CACGTCGTAGCAAACCACC; Bax-R is CCAGTTCATCTCCAATTCG, and Bax-F is CTACAGGGTTTCATCCAG; Bcl2-F is GTGGATGACTGAGTACCT, and Bcl2-R is CCAGGAGAAATCAAACAGAG; VEGF-R is TTTCTCCGCTCTGAACAAGG and VEGF-F is AAAAACGAAAGCGCAAGAAA, β-actin-R (CTCTCAGCTGTGGTGGTGAA) and β-actin-F (AGCCATGTACGTAGCCATCC) were used in qRT-PCR (10 µL) Sybr Green. The qRT-PCR PikoReal Thermo Scientific apparatus (PR0241401024) was run in 35 cycles, consisting of 10 s at 95 °C, 10 s at 55 °C, and 5 s at 72 °C. At 95 °C, the first denaturation process lasted for 5 min. Equation 2^−ΔΔCt was utilized to compute the fold difference between each gene expression, while the β-actin mRNA levels from the same sample were used for comparison (Abu Rakhey et al. 2022).

Histopathology PCa tissue analyses After being collected, the PCa samples were fixed by dipping them into a formalin/saline solution (10%), embedded in paraffin, and sectioned. The degree of histological changes in the PCa tissue was assessed using the staining dye haematoxylin and eosin (H&E). Every slide was examined under a light microscope, and images were captured (Al Hoque et al. 2023).

Regarding statistical analysis The data were formatted as mean ± standard deviation (SD). The statistical variances in the data were verified using one-way analysis of variance (ANOVA). When determining statistical significance, P values less than 0.05 were used. The groups were compared using the post hoc analysis tool of SPSS 25.0.

Results

RRBP-CNP characterization In accordance with Fig. 2 the particle size of RRBP-CNP mapped by TEM and particle size analyzer (Fig. 2a, c), SEM results showing surface morphology of the nanocomposites illustrating the conjugation of RRBP to CNP (Fig. 2b), zeta potential (Fig. 2d), characteristic (UV–visible) absorption peaks for RRBP before and after conjugation with CNP (Fig. 2e), characteristic (PL) photoluminescence peaks for RRBP before and after conjugation with CNP (Fig. 2f), characteristic FTIR bands found that match the vibrations of the functional groups that are present in RRBP before and after conjugation with CNP represented on (Fig. 2g), as well as XRD the characteristic peaks observed at 2θ value of CNP broad band at 24° and RRBP before and after conjugation with CNP indicating high crystallinity and phase purity (Fig. 2h), and EDX elemental analysis illustrating the presence of C, K, N, Fe, S in the CNP in correct state alongside with RRBP content (Fig. 2i), demonstrating the correct and well preparation of CNP as well as correct conjugation and nanocomposite formation in nanoscale. The overall results indicated that RRBP-CNP was properly synthesized in compliance with earlier research (Kim et al. 2019; Bhandari et al. 2021).

Fig. 2

RRBP-CNP characterization. a–d (TEM, SEM, particle size, zeta potential of RRBP-CNP), e–h (UV–Vis spectra, PL, FTIR transmittance and absorbance, XRD of (1. RRBP-CNP, 2. RRP, 3 RBP)), i EDX of RRBP-CNP

Cytotoxicity of XPDT, SDT and SXPDT on the PCA DU-145 cell line in (RRBP-CNP) presence and absence Using the SRB viability test, the cytotoxic effect of various activation methods in presence and absence of EP@RRBP-CNP was examined in PCa-DU-145 cells following 24-h treatments. Treatment of the PCa-DU-145 cell line with varied EP@RRBP-CNP dosages and activation modes resulted in an increase in floating cells and a modification of cellular shape. Furthermore, PDT, SDT, and SXPDT with and without RRBP-CNP were investigated using the SRB cytotoxicity test. The results manifested that EP@RRBP-CNP inhibited PCa-DU-145 cell proliferation in a dose-dependent way. The PCa-DU-145 cell line was also marginally impacted by treatment with RRBP-CNP without activation, according to the results of the current study's cytotoxicity investigation. This was followed by treatment of the PCa-DU-145 cell line with X-ray and ultrasound without EP@RRBP-CNP. The addition of EP@RRBP-CNP enhances the cytotoxic efficacy of PCa-DU-145 cells as well as growth inhibition due to X-ray (XPDT) and ultrasound (SDT). The obtained results illustrated that US is more effective and cytotoxic than X-ray against the PCA DU-145 cell line, both with and without the EP@RRBP-CNP. US was selected for X-ray integration. The combined therapy strategy (SXPDT) with EP@RRBP-CNP is the most cytotoxic effective when used against the PCa- DU-145 cell line, as compared to using X-ray or US alone. The concentration at which viable cells are 50% inhibited by EP@RRBP-CNP (IC50) was found by plotting cell viability vs. concentration; this value is shown in μg/ml in Fig. 3a.

Fig. 3

a The impact of various treatment approaches on the viability of prostate cancer (DU-145) cells. In all in vitro research groups, cells were subjected to several treatment modalities including serial dilution of EP@RRBP-CNP for 24 h, a. microscopic examinations, and b. dosage response curves. The SRB test was applied to assess cell viability. Viability of cells (%): F(p) = 5.317 (< 0.001*). The data (n = 3) are shown as mean ± SD. ^a,b,c,d,e Significant with (untreated prostate cancer group, non-activated EP@RRBP-CNP-treated group, X-ray subjected group, ultrasound subjected group, X-ray + ultrasound group). b The impact of various treatment approaches on the distribution of prostate cancer (DU-145) cell cycles throughout all in vitro research groups. 1. For a 24-h period, cells were subjected to various treatment modalities; 2. DNA cytometry analysis was applied to assess the cell cycle distribution, and the proportion of total events for each phase of the cell was plotted; SubG1, G0/G1, S, G2/M (%):F(p) = 92.269 (< 0.001*), 21.040 (< 0.001*), 24.871 (< 0.001*), 29.128 (< 0.001*).The data (n = 3) are shown as mean ± SD. ^a,b,c,d,e Significant with (untreated prostate cancer group, non-activated EP@RRBP-CNP-treated group, X-ray subjected group, ultrasound subjected group, X-ray + ultrasound group). c The impact of various treatment approaches on necrosis and apoptosis of prostate cancer (DU-145) across all in vitro research groups. 1. For 24 h, cells were subjected to various treatment modalities; 2. Annexin V-FITC/PI was applied to stain the cells, and various cell populations were plotted as a proportion of the total events. Early apoptosis, late apoptosis, early and late apoptosis, total cell death, necrosis: F(p) = 22.442 (< 0.001*), 1.225E3 (< 0.001*), 576.403 (< 0.001*), 221.856 (< 0.001*), 683.977 (< 0.001*) for. The data (n = 3) are shown as mean ± SD. ^a,b,c,d,e Significant with (untreated prostate cancer group, non-activated EP@RRBP-CNP-treated group, X-ray subjected group, ultrasound subjected group, X-ray + ultrasound group). d The impact of various treatment approaches on the autophagy of prostate cancer (DU-145) across all in vitro research groups. 1. After 24 h of exposure to various treatment modalities, cells were labeled using Cyto-ID autophagosome tracker. 2. Plotting of net fluorescent intensity (NFI; red color) was done in comparison to the control group's basal fluorescence (green color). Autophagy (%): F(p) = 61.235 (< 0.001*). The data (n = 3) are shown as mean ± SD. ^a,b,c,d,e Significant with (untreated prostate cancer group, non-activated EP@RRBP-CNP-treated group, X-ray subjected group, ultrasound subjected group, X-ray + ultrasound group). e The impact of the distinct treatment methods on the migration of prostate cancer patients (DU-145): 1. untreated DU-145; 2. X-ray + ultrasound treatment only; and 3. EP@RRBP-CNP + X-ray + ultrasound treatment. The percentages for wound clousure-24, 48, 72 h are F(p) = 80.297 (< 0.001*), 19.359 (< 0.001*), 19.706 (< 0.001*)..^a,b,c Significant with (untreated prostate cancer group, X-ray + ultrasound group, X-ray + ultrasound + EP@RRBP-CNP group)

Effects of XPDT, SDT and SXPDT on cell cycle distribution when RRBP-CNP is present or absent during PCa DU-145 treatment Treatment of PCa- DU-145 cells with EP@RRBP-CNP at an IC50 equivalent concentration has been shown to increase the population of cell at the G1-phase. Treatment with EP@RRBP-CNP without activation had a minor implication on the PCa-DU-145 cell line. It increased the population of cell at the G1-phase, S-phase and leads to cell death, which was displayed as an increase in the SubG1-phase. Conversely, it emerged a decrease in the G2/M-phase, and this was followed by the PCa-DU-145 cell line irradiated with X-ray and ultrasound without EP@RRBP-CNP. The presence of EP@RRBP-CNP improved the effectiveness of X-ray (XPDT) and ultrasound (SDT) induced growth inhibition, arrest, and distribution of PCa-DU-145 cell line. It also showed an elevation in population of cell at the G1-phase, S-phase triggering cell death, demonstrated as an elevation in SubG1-phase, and this in turn lead to decrease in G2/M-phase. The resulted data illustrated that US is more effective than X-ray against the PCa-DU-145 cell line, both with and without the EP@RRBP-CNP. US was selected for X-ray integration. The combined therapeutic method (SXPDT) in the EP@RRBP-CNP presence is more efficient than using X-ray or US alone when treating the PCa-DU-145 cell line. This cell line showed an elevation in population of cell at the G1-phase, S-phase, as well as an elevation in the SubG1-phase, which in turn, lead to a decrease in the G2/M-phase (Fig. 3b).

Mechanisms of apoptosis and necrosis cell death in XPDT, SDT and SXPDT-treated PCa DU-145 in the presence and absence of (RRBP-CNP) The reduction in cell viability may have been caused by an apoptotic response to EP@RRBP-CNP, according to the SRB test and microscopic analysis. To be able to get additional understanding of the mechanism underlying cell death (apoptosis versus necrosis), PCa-DU-145 cells were exposed to activation several modalities for a whole day, both with and without EP@RRBP-CNP. The treated cells' flow cytometric histogram manifested a shift in population; surviving cells were in the lower left quadrant, followed by early apoptosis in the lower right, late apoptosis in the upper-right quadrant, and cell necrosis in the upper left. An increase in Annexin V positivity was also seen in the treated cells. The proportion of PCa-DU-145 cells that underwent either EP@RRBP-CNP without activation or X-ray and ultrasound without EP@RRBP-CNP treatment showed a significant elevation in early and late apoptotic cell percentages. Adding EP@RRBP-CNP to PCa-DU-145 cells irradiated with X-ray (XPDT) and ultrasound (SDT) enhances the percentage of exhibiting early and late apoptosis cells. The obtained data demonstrated that, in both cases—with and without the EP@RRBP-CNP—US is more efficient than X-ray at increasing the percentage of exhibiting early and late apoptosis PCa-DU-145 cells. US was selected for X-ray integration. Compared to employing X-ray or US alone, the combined SXPDT therapeutic technique in the EP@RRBP-CNP presence is the most efficient way to raise the fraction of PCa-DU-145 cells with early and late apoptosis. Comparable results were seen for the fraction of necrotic cells in PCa-DU-145 cells irradiated with X-ray and ultrasound without EP@RRBP-CNP, or with EP@RRBP-CNP non-activation. When EP@RRBP-CNP is added, the fraction of PCa-DU-145 necrotic cells when cells irradiated with X-ray (XPDT) and ultrasound (SDT) is improved. The results obtained demonstrated that, in both cases—with and without the EP@RRBP-CNP—US is more efficient than X-ray at the necrotic PCa-DU-145 cells percentage rising. When compared to using X-ray or US alone, the combination (SXPDT) therapy method in the EP@RRBP-CNP presence is more efficient in increasing the percentage of PCa-DU-145 cells with necrosis (Fig. 3c).

Mechanisms of autophagy cell death in XPDT, SDT and SXPDT-treated PCa DU-145 in the presence and absence of (RRBP-CNP) The microscopic and SRB assay analysis demonstrated that the reason of the cell viability loss may be programmed cell death rather than autophagic apoptosis in response to EP@RRBP-CNP. To obtain further understanding of the cell death process (autophagy), PCa-DU-145 cells were activated in both the presence and absence of EP@RRBP-CNP using various modalities for a whole day. When AO, a fluorophore that builds up at high concentrations in autolysosomes, acidic vesicular organelles (AVO), dimerizes and induces a green metachromatic shift to red, the treated cells produced more red and less green, which could be evaluated to investigate autophagy. The percentage of PCa-DU-145 cells undergoing autophagy was much higher in those treated with EP@RRBP-CNP without activation or with X-ray and ultrasound without EP@RRBP-CNP. When RRBP-CNP is present, PCa-DU-145 cells treated with both ultrasound (SDT) and X-ray photodynamic treatment (XPDT) have a higher percentage of autophagous cells. The acquired data demonstrated that, both with and without the EP@RRBP-CNP, US is more efficient than X-ray at increasing the proportion of PCa-DU-145 cells undergoing autophagy. US was selected for X-ray integration. When compared to utilizing X-ray or US alone, the combination therapeutic method (SXPDT) in the presence of EP@RRBP-CNP is more effective in increasing the percentage of PCa-DU-145 cells undergoing autophagy (Fig. 3d).

Mechanisms of cell migration inhibition in XPDT, SDT and SXPDT-treated PCa DU-145 in the presence and absence of (RRBP-CNP) PCa-DU-145 cells were utilized to investigate the inhibitory effects of different activation techniques, both with and without EP@RRBP-CNP, on cell migration after a 24-h treatment period. The scratch assay was used to measure wound closure every day until the control, untreated cells closed after 72 h. The PCa-DU-145 cell line treated with the combined therapeutic (SXPDT) method in the EP@RRBP-CNP presence shown a substantial decrease in PCa-DU-145 cell migration regarding the control untreated group, suggesting a potential anti-migratory effect (Fig. 3e).

Oxidative stress and XPDT, SDT, SXPDT in in vivo PCa models in the presence and absence of (RRBP-CNP) The effects of EP@RRBP-CNP; XPDT, SDT, and SXPDT on the MDA parameter for oxidative stress and lipid peroxidation in the mice of each experimental group are shown in (Fig. 4a). The MDA in the sera of the mice group treated with EP@RRBP-CNP alone and non-irradiated revealed very slight modifications as compared to the untreated MNU/testosterone-PCa-induced control mouse group. Regarding control healthy normal mice, the untreated MNU/testosterone-PCa-induced control animals exhibited noticeably higher levels of this parameter. Additionally, with regard to the normal control mice, all MNU/testosterone-PCa-induced mice irradiated with X-ray, ultrasound, or X-ray and ultrasound alone combined groups demonstrated a significant elevation in MDA concentrations. When EP@RRBP-CNP was administered, MDA levels were significantly decline in the X-ray, US, and combination of X-ray and US activated groups than in the MNU/testosterone-PCa-induced control animals; however, this impact did not achieve the normal level of control mice.

Fig. 4

a The impact of various treatment approaches on MDA, antioxidant activities, and capacity across all research groups. F represents the ANOVA test value. 1–8. GR (mU/ml), GSH (mg/dl), GST (U/ml), GPx (mU/ml), SOD (U/ml), CAT (mU/ml), TAC (mM/L), MDA (nmol/ml): F(p) = 100.575 (< 0.001*), 433.374 (< 0.001*), 1.291E3 (< 0.001*), 2.947E4 (< 0.001*), 3.737E6 (< 0.001*), 1.617E5 (< 0.001*), 3.312E3 (< 0.001*), 9.635E4 (< 0.001*). ^a,b,c,d,e Significant with (untreated prostate cancer group, non-activated EP@RRBP-CNP-treated group, X-ray subjected group, ultrasound subjected group, X-ray + ultrasound group). b The impact of various treatment approaches on hepatic and renal biomarkers and tissues histopathology across all research groups. F represents the ANOVA test value. ALT (U/l), AST (U/l), urea (mg/dl), creatinine (mg/dl): F(p) = 5.718E3 (< 0.001*), 1.562E5 (< 0.001*), 4.359 E3 (< 0.001*), 432.564 (< 0.001*). H&E stained liver and kidney tissues. 1. Normal untreated group, 2. MNU/testosterone induced PCa group untreated, 3. PCa group subjected to EP@RRBP-CNP without activation, 4. PCa group subjected to X-ray only, 5. PCa group subjected to X-ray in presence of EP@RRBP-CNP, 6. PCa group subjected to ultrasound only, 7. PCa group subjected to ultrasound in presence of EP@RRBP-CNP, 8. PCa group subjected to combined modalities X-ray/ultrasound only, 9. PCa group subjected to combined modalities X-ray/ultrasound in presence of EP@RRBP-CNP. ^a,b,c,d,e Significant with (untreated prostate cancer group, non-activated EP@RRBP-CNP-treated group, X-ray subjected group, ultrasound subjected group, X-ray + ultrasound group). c The impact of various treatment modalities on the relative gene expressions of TNF alpha, Bax, Caspase (9,3), p53, VEGF, and Bcl-2 as measured by qRT-PCR in each research group. F represents the ANOVA test result. p53, Bax, Caspase 9, Caspase 3, TNFalpha, VEGF, Bcl-2: F(p) = 465.019 (< 0.001*), 511.948 (< 0.001*), 960.242 (< 0.001*), 1.123E3 (< 0.001*), 362.922 (< 0.001*), 188.811 (< 0.001*), 201.020 (< 0.001*). ^a,b,c,d,e Significant with (untreated prostate cancer group, non-activated EP@RRBP-CNP-treated group, X-ray subjected group, ultrasound subjected group, X-ray + ultrasound group). d The H&E-stained segment of prostate tissue in all research groups, which illustrates the impact of various treatment regimens at the cellular level; ventral (VP), dorsolateral (DLP), and anterior (AP) prostate lobes. 1. Normal prostate untreated group, 2. MNU/testosterone-induced PCa group untreated, 3. MNU/testosterone-induced PCa group subjected to EP@RRBP-CNP without activation, 4. MNU/testosterone-induced PCa group subjected to X-ray only, 5. MNU/testosterone-induced PCa group subjected to X-ray in presence of EP@RRBP-CNP, 6. MNU/testosterone induced PCa group subjected to ultrasound only, 7. MNU/testosterone-induced PCa group subjected to ultrasound in presence of EP@RRBP-CNP, 8. MNU/testosterone-induced PCa group subjected to combined modalities X-ray/ultrasound only, 9. MNU/testosterone-induced PCa group subjected to combined modalities X-ray/ultrasound in presence of EP@RRBP-CNP

Antioxidant system and XPDT, SDT, SXPDT in vivo PCa models in the presence and absence of (RRBP-CNP) Fig. 4a shows how the antioxidant markers (SOD, catalase, TAC, GPx, GST, and GR) were impacted in each of the mouse research groups by EP@RRBP-CNP, XPDT, SDT, and SXPDT. The EP@RRBP-CNP alone without activation was contrasted with the MNU/testosterone-PCa-induced control group. Changes in the activity of GPx, GST, GR, catalase, and SOD and TAC level, were only slightly significant. SOD, catalase, GPx, GST, GR, and TAC levels were significantly lower in the untreated control MNU/testosterone-PCa-induced animals than in the normal control mice. In addition, both MNU/testosterone-PCa-induced animal groups treated with X-ray, ultrasound, or X-ray and ultrasound combination alone demonstrated a significant decline in TAC levels and in the SOD, catalase, GPx, GST, and GR activities regarding the mice healthy control group. Compared to the untreated MNU/testosterone-PCa-induced control mice, activated EP@RRBP-CNP in the X-ray, US, and combination of X-ray and US groups demonstrated a considerable elevation in the SOD, catalase, GPx, GST, and GR, activities and TAC level while not approaching the level of normal control group.

The liver functions and XPDT, SDT, SXPDT in vivo PCa models in the presence and absence of (RRBP-CNP) The liver function tests data for each study group are displayed in Fig. 4b. The mice treated with EP@RRBP-CNP alone and non-irradiation demonstrated only slightly different changes in their levels of AST and ALT from the untreated MNU/testosterone-PCa-induced control group, despite the fact that the sera levels of this group were notably increased than those of the healthy normal control mice. Moreover, ALT and AST levels were notably higher in all MNU/testosterone-PCa-induced mice irradiated with X-ray, ultrasound, or X-ray and ultrasound combination alone groups than in the control normal group. Furthermore, when EP@RRBP-CNP was administered to the X-ray, US, and combination of X-ray and US activated groups, the level of AST and ALT was drastically lowered in contrast to the untreated MNU/testosterone-PCa-induced control mice; however, the levels of normal control group were not attained.

The kidney functions and XPDT, SDT, SXPDT in vivo PCa models in the presence and absence of (RRBP-CNP) The data of the renal function tests conducted on each of the research groups are displayed in Fig. 4b. The levels of urea or creatinine in EP@RRBP-CNP-treated mice with solely and non-irradiated demonstrated only marginally considerable changes regarding the MNU/testosterone-PCa-induced mice untreated control; however, these parameter levels in the MNU/testosterone-PCa-induced mice untreated control were notably higher regarding the control healthy normal mice. Moreover, creatinine and urea levels were statistically significantly higher in all MNU/testosterone-PCa-induced mice irradiated with X-ray, ultrasound, or X-ray and ultrasound combination alone groups than in the control normal group. Additionally, the treatment of EP@RRBP-CNP in the X-ray, US, and combination of X-ray and US-activated groups notably decline the levels of urea and creatinine with regard to the MNU/testosterone-PCa-induced control untreated mice; however, the levels of normal control group were not attained.

Anticancer, antiproliferative, and antiangiogenic effects and XPDT, SDT, SXPDT in vivo PCa models in the presence and absence of (RRBP-CNP) In all study groups, Fig. 4c illustrates how RRBP-CNP affects the p53, Bax, TNF alpha, Caspase (3, 9), VEGF, and Bcl-2 relative genes expressions. The p53, Bax, TNF alpha, Caspase (3, 9), VEGF, and Bcl-2 expression altered very marginally when EP@RRBP-CNP was given to mice solely non-activated compared to the untreated control MNU/testosterone-PCa-induced group. On the other hand, the levels of p53, Bax, TNF alpha, and caspase (3, 9) in the untreated BBN-PCA-induced control group were considerably lower than those of healthy normal control mice, while those of VEGF and Bcl-2 were significantly higher. In addition, all MNU/testosterone-PCa-induced mice irradiated with X-ray, ultrasound, or X-ray and ultrasound combination only groups demonstrated significantly declined levels of p53, TNF alpha, Bax, and caspase (3, 9) expressions and notably increased levels of VEGF and Bcl-2 expressions when regarding the healthy control group of mice. Regarding the untreated MNU/testosterone-PCa-induced control group, the delivery of EP@RRBP-CNP to the X-ray, US, and combination of X-ray and US-activated groups led to significant decline in the expressions of the Bcl-2 and VEGF genes and elevation in the p53, Bax, TNF alpha, and caspase (3, 9) expressions.

Histopathological effect and XPDT, SDT, SXPDT in vivo PCa models in the presence and absence of (RRBP-CNP) Sections of tissue stained with H&E from every mouse study group are shown in Fig. 4d, which illustrates the effects of EP@RRBP-CNP, XPDT, SDT, and SXPDT on PCa brought on by MNU/testosterone. The histological analysis revealed that every tumor in the untreated MNU/testosterone-PCa-induced control group included 5% necrosis and was made up entirely of extensively cancerous cells. The MNU/testosterone histologically caused PCa tissues in the EP@RRBP-CNP-treated mice solely and non-irradiated, exhibited only slightly significant changes as compared to the untreated control MNU/testosterone-PCa-induced mice. Regarding the untreated MNU/testosterone-PCa-induced control mice, the injection of EP@RRBP-CNP in the X-ray, ultrasound, and X-ray and ultrasound combination-activated groups showed considerably necrotic big foci regions (95–98%). Furthermore, with regard to the untreated MNU/testosterone-PCa-induced control group, all MNU/testosterone-PCa-induced mice irradiated with X-ray, US, or a combination of X-ray and US only showed significant areas of necrosis.

Discussion

In the near future, scientific research and healthcare are anticipated to be significantly impacted by the rapidly developing field of nanotechnology. Thus, it is anticipated that nanotechnology will discover a solution to one of the most pressing issues, "cancer treatment". The development and application of nanomaterials in PCa treatment has garnered significant attention in recent years. Improvements in the production of charge-loaded, particle-sized, defined-geometry, organic and inorganic nanomaterials with ligand attachment have led to greater biocompatibility and active targeting at the cancer site. Despite all of the advancements over the years in the discovery of medications, techniques, and novel biomarkers for prostate cancer (PCa), chemotherapy is a common treatment for men with prostate cancer. Unfortunately, the tumor cells are diverse and grow clinically slowly, which makes them resistant to treatment and prone to recurrence. By means of targeted distribution via nanocarriers, nanomedicines have the potential to improve medication accumulation at the tumor site, maintain drug release, and mitigate drug resistance. Furthermore, by utilizing nanomedicines in combination therapy, it is possible to target various cancer pathways, increasing efficacy and treating tumor heterogeneity. Using nanomedicine in the treatment of prostate cancer would be a significant tactic to manage the dynamic process of the tumor and increase survival (Barani et al. 2020; Zhao et al. 2022; Adekiya and Owoseni 2023).

The SRB assay results are reliable for determining the exact number of viable cells and assessing the cytotoxicity of medications used to treat cancer. One of the primary factors contributing to cancer is the cell cycle disruption, which is the fundamental system controlling a cell's life processes. Furthermore, apoptosis, necrosis, and autophagy are the three types of cell programmed death that maintain the balance of biological processes involved in proliferation and are essential for normal development. Tumor growth and metastasis are thought to be associated with abnormal proliferation and suppressed apoptosis, as most malignancies rely on the ability of tumor cells to outnumber apoptosis in order to live (Kim et al. 2012; Tonder et al. 2015; Noguchi et al. 2020).

The results of this study's cytotoxicity (SRB assay) as well as cell cycle analysis, necrosis, apoptosis, and autophagy (flow cytometry) revealed that the PCa-DU-145 cell line was mostly unaffected by treatment with non-activated EP@RRBP-CNP after a 24-h incubation period. Without EP@RRBP-CNP, the application of X-ray and ultrasound had no discernible effect on the PCa-DU-145 cell line. When EP@RRBP-CNP is present, both the ultrasound (SDT) and X-ray (XPDT) are more effective. The obtained results showed that when treating the PCa-DU-145 cell line, the therapeutic (SXPDT) combined approach is more efficient than either X-ray or US alone (decline of cell viability in a dose-dependent manner, slowed down of progression of cell cycle in G0/G1-phase, and cell death was provoked as revealed by rise in Early-G cell population, an elevation in necrosis, early and late apoptosis, and an increase in autophagic cell death). Our results are in line with earlier studies (Bourassa et al. 1997; Janczyk et al. 2004; Chen et al. 2017; Lan et al. 2020; Tan et al. 2017; Zhou et al. 2021; Sanina et al. 2017) demonstrating the inhibitory effect (cell cycle arrest; down of progression of cell cycle in G0/G1-phase), as well as destroying tumor cells (decline of cell viability in a dose-dependent manner, necrosis, apoptosis, autophagy) was maximum in presence of EP@RRBP-CNP as sensitizer combined with both X-ray (-photo) and ultrasound (-sono) activation (SXPDT) followed by EP@RRBP-CNP ultrasound only (SDT activation and laser activation only (XPDT) and that SXPDT superior to SDT and PDT.

Pathways to investigate the key processes in human PCa are made possible by experimental models with well-defined etiological agents that allow the development of this particular tumor type. In certain mouse models, the combination of the carcinogen N-methyl-N-nitrosourea (MNU) and the androgen testosterone has shown promise as a short-term treatment to increase the incidence of prostate cancer. MNU, a well-known direct-acting methylating agent, interacts with proteins and DNA in cells to produce comparatively high concentrations of O6-methylguanine, a DNA adduct that has cytotoxic and recombinogenic effects. MNU has also been linked to an increased risk of cancer. Experimental animal models of the prostate treated with MNU and androgen represent anatomically and physiologically appropriate systems for the preclinical assessment of compounds that may increase or prevent human prostate carcinogenesis (Adekiya and Owoseni 2023; Nascimento-Goncalves et al. 2023; Du et al. 2018).

The present study provides evidence of the oxidants that are driving the advancement of MNU/testosterone-induced PCa. The untreated control MNU/testosterone-PCa-induced mice had noticeably increased MDA levels. All treated EP@RRBP-CNP groups (non-activated, X-ray-, ultrasound-, X-ray and ultrasound combination-activated mice) had significantly lower MDA levels than the untreated control MNU/testosterone-PCa-induced animals. The antioxidant system is further disrupted by significant decreases in the in the GPx, GST, GR, catalase, SOD activity and TAC backup and. The MNU/testosterone-PCa-induced control mice that were not given any treatment had noticeably reduced antioxidant levels. Compared to untreated MNU/testosterone-PCa-induced control mice, antioxidant levels were significantly greater in all treated EP@RRBP-CNP groups (X-ray-, ultrasound-, X-ray and ultrasound combined-activated mice). Prior research has demonstrated that induction of MNU/testosterone-PCa causes a noteworthy drop in TAC, GPx, GST, GR, catalase, and SOD activity, as well as a notable increase in MDA (Abu Rakhey et al. 2022; Mabrouk et al. 2002; Bisson et al. 2008; Kumar et al. 2012; Sharmila et al. 2014; Abd El-Kaream et al. 2019a, 2023; Abdulrahman et al. 2020; Dardeer et al. 2021a). It was found that, in comparison to mice from a normal, healthy control group, mice with PCa produced by MNU/testosterone had decreased capacity in free radicals scavenging and were more susceptible to lipid peroxidation. A surplus and accumulation of reactive oxygen species (ROS) in addition an increase in the oxidation polyunsaturated fatty acid phospholipid bilayers of cell, which in turn boosts MDA levels, are the results of MNU/testosterone-PCa-induction, as was previously noted. One crucial stage in the emergence of oxidative stress and cancer is the degradation of enzymatic and non-enzymatic antioxidants. Because MNU/testosterone-PCa-induced ROS and their metabolites required the detoxification of these antioxidants, both non-enzymatic and enzymatic, their constant depletion explained why they were deficient. The catalytic activity of enzymatic antioxidants could be compromised by the build-up of ROS (Abu Rakhey et al. 2022; Kumar et al. 2012; Sharmila et al. 2014; Abd El-Kaream et al. 2019a, 2023; Abdulrahman et al. 2020; Dardeer et al. 2021a; Arroyo-Acevedo et al. 2017). Our results showed how the non-activated portion of EP@RRBP-CNP's ability to scavenge free radical production, hence lowering MDA levels, supports its anti-lipid peroxidative effect. Further evidence of the efficacy of EP@RRBP-CNP action as SXPS and its activation by XPDT, SDT, and SXPDT, that eliminated MNU/testosterone-PCa cancerous cells—the main source of reactive oxygen species—and led to an increase in antioxidant enzyme activities, a restoration of the antioxidant system, and a delay in the progression of the cancerous state to a nearly normal state. Our findings concurred with earlier research (Abu Rakhey et al. 2022; Zhou et al. 2021; Sanina et al. 2017; Nascimento-Goncalves et al. 2023; Du et al. 2018; Gal et al. 2020; Abd El-Kaream et al. 2019c, 2024, 2024; Dardeer et al. 2021b) manifesting the SXPDT biochemical impact (decline of MDA level and restoring enzymatic and non-enzymatic antioxidants to near normal levels; destroying MNU/testosterone-induced PCa tumor cells, the main source of ROS, as well as blocking the antioxidants exhausting by ROS evolved from MNU/testosterone-induced PCa cells) was maximum in presence of EP@RRBP-CNP as sensitizer combined with both X-ray (-photo) and ultrasound (-sono) activation followed by EP@RRBP-CNP ultrasound only activation and laser activation only and that SXPDT superior to SDT and PDT.

There was a significant elevation in ALT and AST in the MNU/testosterone-PCa-induced groups in our study, indicating liver cell injury. Increased serum concentrations of a number of liver enzymes are linked to those enzymes cellular leaking into the bloodstream, a sign of hepatocyte membrane integrity being compromised (Abu Rakhey et al. 2022; Mabrouk et al. 2002; Bisson et al. 2008; Kumar et al. 2012; Sharmila et al. 2014; Palanirajan et al. 2022; Chung et al. 2024; Rojas-Armas et al. 2020). The present study's results are in line with earlier research, which indicates that MNU/testosterone-induced animals had lower hepatic function with regard to normal control mice. This is likely because of the disruption of metabolism caused by MNU/testosterone, which also leads to organ failure (Abu Rakhey et al. 2022; Zhou et al. 2021; Sanina et al. 2017; Nascimento-Goncalves et al. 2023; Du et al. 2018; Abd El-Kaream et al. 2018, 2019b, 2019c, 2024, 2024; Jasim et al. 2019; Gal et al. 2020; Dardeer et al. 2021b; Palanirajan et al. 2022; Chung et al. 2024; Rojas-Armas et al. 2020). The results of the present investigation showed that EP@RRBP-CNP protected the liver by lowering ALT and AST levels. Moreover, this reinforces EP@RRBP-CNP's preventive effectiveness in preventing hepato-dysfunction in mice that is caused by MNU/testosterone-PCa. In this study, MNU/testosterone also clearly elevated the levels of creatinine and urea in the MNU/testosterone-induced groups, indicating kidney injury. Renal failure in MNU/testosterone-PCa-induced mice has been shown to be caused by cardiac and hepatic injury, leading to increased tubular and glomerular congestion. The entire capillary and tubule system experiences a rise in renal interstitial pressure as a result of this congestion. The results of this study demonstrate that MNU/testosterone-PCa-induced animals exhibited reduced renal function in comparison to control normal mice, which is consistent with earlier findings (Abu Rakhey et al. 2022; Zhou et al. 2021; Sanina et al. 2017; Nascimento-Goncalves et al. 2023; Du et al. 2018; Abd El-Kaream et al. 2019b, 2019c, 2024, 2024; Jasim et al. 2019; Gal et al. 2020; Dardeer et al. 2021b; Arroyo-Acevedo et al. 2019; Bosland et al. 2023). The current investigation found that EP@RRBP-CNP induced kidney protection by lowering serum levels of urea and creatinine. Additionally, study demonstrates that EP@RRBP-CNP can prevent renal impairment in mice caused by MNU/testosterone-PCa. Our research showed that the non-activated portion of EP@RRBP-CNP protects the liver and kidneys by scavenging free radicals produced by MNU/testosterone-PCa induction. Activated EP@RRBP-CNP also effectively removes MNU/testosterone, the main source of ROS, leading to the restoration of liver and kidney function as well as a shift from a cancerous to a nearly normal state. This ameliorating effect was maximum in presence of EP@RRBP-CNP as sensitizer combined with both X-ray (-photo) and ultrasound (-sono) activation followed by EP@RRBP-CNP ultrasound only activation and laser activation only and that SXPDT superior to SDT and PDT.

In the current investigation, we molecularly examined the p53, TNF alpha, Bax, VEGF, Caspase (3,9), and Bcl-2 expressions as markers of BBN-induced PCA therapy and inhibition of angiogenesis,. The findings show a strong positive link between the therapy and gene expressions in the presence of EP@RRBP-CNP using various modalities, but a notably negative correlation between the gene expressions and MNU/testosterone-PCa-induction. The p53, TNF alpha, Bax, and caspase 3, 9 expressions was considerably higher in the groups receiving sono–X-ray–photodynamic treatment with EP@RRBP-CNP than in the XPDT or SDT with EP@RRBP-CNP, X-ray or US alone without EP@RRBP-CNP, and the untreated MNU/testosterone-PCa-induced mice. Conversely, expressions of VEGF and Bcl-2 correlated positively in the MNU/testosterone-PCa-induced mice that were left untreated, but expressions of VEGF and Bcl-2 correlated negatively with various modalities when EP@RRBP-CNP was present. The Bcl-2 and VEGF genes expressions were significantly decline in mice subjected to SXPDT therapy with (EP@RRBP-CNP) with regard to mice irradiated with XPDT or SDT solely with (EP@RRBP-CNP), and then X-ray or US solely without (EP@RRBP-CNP). When MNU/testosterone-PCa stimulated mice, the untreated group exhibited the highest expression level. The outcomes of our investigation, which align with prior research, demonstrate the validity of p53, TNF alpha, Bax, VEGF, Caspase (3,9), and Bcl-2 genes expressions as trustworthy markers of treatment-relevant malignancy (Abu Rakhey et al. 2022; Abd El-Kaream et al. 2019c, 2024, 2024; Dardeer et al. 2021b; Palanirajan et al. 2022; Chung et al. 2024; Rojas-Armas et al. 2020; Arroyo-Acevedo et al. 2019; Bosland et al. 2023), illustrating the SXPDT molecular level implications (down regulation of VEGF and Bcl-2 levels; restricting the proliferation and limiting the angiogenesis capabilities of MNU/testosterone-induced PCa tumor cells) as well as (upregulation of pro-apoptotic genes p53, caspase 3, 9, Bax, and TNF alpha; directing MNU/testosterone-induced PCa tumor cells to be destroyed by either programmed cell death or necrosis and alerting the immune system) was maximum in presence of EP@RRBP-CNP as sensitizer combined with both X-ray (-photo) and ultrasound (-sono) activation followed by EP@RRBP-CNP ultrasound only activation and laser activation only and that SXPDT superior to SDT and PDT.

According to our current research, EP@RRBP-CNP may be employed as a photo- and ultrasound sensitizer to treat BBN-induced in vivo PCA. The EP@RRBP-CNP, which may be induced by chemical activation processes mediated by X-ray photons or ultrasound, dramatically suppresses tumor growth and results in cell death. One explanation for the sono–X-ray–photo-chemical/physical mechanisms that underlie the biological effects of SXPDT could be that an electron is propelled into a higher energy orbital by X-ray photon and ultrasound, which excite a ground state SXPS (EP@RRBP-CNP) molecule in a singlet state. At lower energies, the excited triplet state SXPS has a relatively lengthy half-life (~ microseconds) before reverts from the excited state to the ground state by internal or fluorescence conversion (~ nanoseconds). Alternatively, the excited electron's spin inverts. In a spin-forbidden transfer, phosphorescence returns to the ground singlet state and loses its excitation energy. The two possible outcomes of triplet oxygen excitation are: either it transfers an electron to superoxide anions, producing a range of ROS that can cause significant damage to biological systems, or it transfers its energy to triplet molecular oxygen, producing reactive biologically excited singlet state oxygen. Innate and adaptive immune systems both mount a strong defense in response to SXPDT. It also causes cell death via a number of different pathways, such as necrosis, autophagy, and apoptosis.

Finally, in the presence of EP@RRBP-CNP, anticancer effects can be achieved through the use of ultrasound and X-ray, In vitro (the cell cycle was arrested; increase in the cells population during the G0/G1-phase, cell death was induced; in a dose-dependent manner cell viability declined, increase in cell population in the Pre-G, autophagic cell death, as well as necrosis and early and late apoptosis) and in vivo MNU/testosterone-PCa-induced mice (successfully slowing the growth of tumors and even killing cancer cells; induced antiproliferative genes, p53, caspase 3,9, Bax, TNFalpha, repressed antiangiogenic and antiapoptotic genes, VEGF and Bcl2, respectively, as well as lowering oxidative stress (MDA), improving the functions of the kidneys (urea, creatinine), liver (ALT, AST), and antioxidants (GPx, GPx, GST, CAT, GSH, TAC). It is proposed that a highly successful anticancer treatment is X-ray photon-dynamic therapy combined with sono-dynamic therapy. Our findings indicate that EP@RRBP-CNP has a promising potential as a novel sensitizer and efficient drug delivery method for SXPDT, or sono–X-ray–photodynamic treatment.

Conclusion

The present work delivered substantial outcomes involving the application electroporation of conjugated carbon nanoparticles of Roussin red and black porphyrin-based salt (RRBP-CNP) as a delivery sensitizer system for sono–X-ray photodynamic therapy (SXPDT) of prostate cancer in vitro (using the DU-145 cell line) and (using MNU/testosterone-induced mice) in vivo demonstrated significant results in this work, indicating promising outcomes in the treatment of cancer. In addition, RRBP-CNP's many benefits, including its low systemic toxicity and excellent bioavailability, make it a feasible alternative for treating cancer. Moreover, the combination of EP@RRBP-CNP@X-ray@US has opened up a wide range of options for anticancer drugs for the effective eradication of prostate cancer.

Recommendation

The current study has revealed the potential of conjugated carbon nanoparticles from Roussin red and black porphyrin-based salt assisted by electroporation (EP@RRBP-CNP) as a novel sensitizer in conjunction with sono–X-ray photodynamic therapy (SXPDT), a therapeutic approach that still needs more confirmation and further validation for the treatment of prostate cancer. It is strongly advised to conduct additional research using techniques that safely apply this contemporary advanced technology and approach to people and monitor modifications in various biochemical and/or biophysical indicators.